--- name: bio-read-qc-adapter-trimming description: Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads. tool_type: cli primary_tool: cutadapt --- ## Version Compatibility Reference examples tested with: FastQC 0.12+, Trimmomatic 0.39+, cutadapt 4.4+, fastp 0.23+ Before using code patterns, verify installed versions match. If versions differ: - CLI: ` --version` then ` --help` to confirm flags If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Adapter Trimming Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized). **"Trim adapters from reads"** → Remove sequencing adapter sequences from FASTQ reads to prevent adapter contamination in downstream alignment. - CLI: `cutadapt -a ADAPTER -o out.fq in.fq` or `trimmomatic PE` with ILLUMINACLIP - CLI: `fastp -i in.fq -o out.fq` (auto-detects adapters) ## Common Adapter Sequences | Platform/Kit | Adapter | Sequence | |--------------|---------|----------| | Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA | | Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | | Nextera | Transposase | CTGTCTCTTATACACATCT | | Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG | | Poly-A | Poly-A tail | AAAAAAAAAAAAAAAA | ## Cutadapt ### Single-End Reads ```bash # 3' adapter (most common) cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz # 5' adapter cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz # Both ends cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz # Multiple adapters (tries each) cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz ``` ### Paired-End Reads ```bash # Basic paired-end cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \ -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \ -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \ sample_R1.fastq.gz sample_R2.fastq.gz # Short form for Illumina TruSeq (auto-detect) cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC \ -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \ sample_R1.fastq.gz sample_R2.fastq.gz ``` ### Adapter Options ```bash # Error rate (default 0.1 = 10% mismatches allowed) cutadapt -a ADAPTER -e 0.15 -o out.fq in.fq # Minimum overlap (default 3) cutadapt -a ADAPTER -O 5 -o out.fq in.fq # No indels in adapter alignment cutadapt -a ADAPTER --no-indels -o out.fq in.fq # Trim Ns from ends cutadapt --trim-n -o out.fq in.fq # Anchored adapters (must be at end) cutadapt -a ADAPTER$ -o out.fq in.fq ``` ### Linked Adapters ```bash # 5' adapter followed by 3' adapter (same read) cutadapt -a ADAPTER1...ADAPTER2 -o out.fq in.fq # Anchored 5' linked to 3' cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fq in.fq ``` ### Filtering After Trimming ```bash # Minimum length (discard shorter) cutadapt -a ADAPTER -m 20 -o out.fq in.fq # Maximum length cutadapt -a ADAPTER -M 150 -o out.fq in.fq # Maximum N content cutadapt -a ADAPTER --max-n 0.1 -o out.fq in.fq # Discard trimmed reads cutadapt -a ADAPTER --discard-trimmed -o out.fq in.fq # Discard untrimmed reads cutadapt -a ADAPTER --discard-untrimmed -o out.fq in.fq ``` ### Paired-End Filtering ```bash # Both reads must pass minimum length cutadapt -a ADAPT1 -A ADAPT2 -m 20 \ -o R1.fq -p R2.fq in_R1.fq in_R2.fq # Output too-short reads separately cutadapt -a ADAPT1 -A ADAPT2 -m 20 \ --too-short-output short_R1.fq --too-short-paired-output short_R2.fq \ -o R1.fq -p R2.fq in_R1.fq in_R2.fq ``` ### Action Options ```bash # Mask adapter instead of trim (replace with N) cutadapt -a ADAPTER --action=mask -o out.fq in.fq # Retain adapter but lowercase cutadapt -a ADAPTER --action=lowercase -o out.fq in.fq # Just find adapters, don't modify cutadapt -a ADAPTER --action=none -o out.fq in.fq ``` ## Trimmomatic ### Single-End Mode ```bash trimmomatic SE -phred33 \ input.fastq.gz output.fastq.gz \ ILLUMINACLIP:adapters.fa:2:30:10 ``` ### Paired-End Mode ```bash trimmomatic PE -phred33 -threads 4 \ input_R1.fastq.gz input_R2.fastq.gz \ output_R1_paired.fastq.gz output_R1_unpaired.fastq.gz \ output_R2_paired.fastq.gz output_R2_unpaired.fastq.gz \ ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10 ``` ### ILLUMINACLIP Parameters ```bash ILLUMINACLIP:::: # Parameters: # seed - max mismatches in 16bp seed (usually 2) # palindrome - threshold for palindrome match (usually 30) # simple - threshold for simple match (usually 10) # Example with all options ILLUMINACLIP:adapters.fa:2:30:10:2:keepBothReads ``` ### Built-in Adapter Files Trimmomatic includes adapter files: - `TruSeq2-SE.fa` - TruSeq v2 single-end - `TruSeq2-PE.fa` - TruSeq v2 paired-end - `TruSeq3-SE.fa` - TruSeq v3 single-end - `TruSeq3-PE.fa` - TruSeq v3 paired-end - `TruSeq3-PE-2.fa` - TruSeq v3 PE (palindrome mode) - `NexteraPE-PE.fa` - Nextera paired-end ### Find Trimmomatic Adapters ```bash # Find adapter directory TRIMMOMATIC_JAR=$(which trimmomatic | xargs dirname)/../share/trimmomatic-*/adapters/ # Or with conda ls $CONDA_PREFIX/share/trimmomatic-*/adapters/ ``` ## Performance ```bash # Cutadapt with multiple cores cutadapt -j 8 -a ADAPTER -o out.fq in.fq # Trimmomatic threads trimmomatic PE -threads 8 ... ``` ## Verify Trimming ```bash # Check adapter removal with FastQC fastqc trimmed.fastq.gz # Count reads before/after zcat input.fastq.gz | wc -l zcat trimmed.fastq.gz | wc -l ``` ## Related Skills - quality-reports - Check adapter content with FastQC - quality-filtering - Quality trimming after adapter removal - fastp-workflow - Combined adapter and quality trimming --- Source attribution: GPTomics Original project: https://github.com/GPTomics/bioSkills License: MIT License information: https://opensource.org/license/mit Original upstream instructions; downloaded from Dave AI. ## Upstream license notice MIT License Copyright (c) 2026 FridrichMethod Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. --- NOTE ON BUNDLED CONTENT This repository aggregates skills from multiple upstream projects (see the README for the source list). Each `skills//` directory may carry its own license inherited from its upstream source. The MIT license above applies to this repository's curation and the scripts/workflows in `/`, `/scripts/`, and `/.github/` — not to the upstream skill content itself. Consult the upstream repository linked in the README and any LICENSE file inside a skill directory before reusing skill content commercially. # Dave AI resource metadata Creator / publisher: GPTomics Original project: https://github.com/GPTomics/bioSkills Attribution basis: Exact package in biomedical source index and publisher source table Fields of work: Data & Analytics, Education & Research Roles: Business Intelligence Analyst, Data Scientist, Researcher Specialties: API Tools: Cutadapt, Fastqc, Trimmomatic Country applicability: Country not specified Classification basis: Source catalog labels Instruction SHA-256: 4c951d45f11aeeb530b0f27c5b1bb76733abdca7ca7e61dc598c551e8834dfe0 Metadata reviewed: 2026-10-27 This metadata supersedes earlier Dave AI catalog attribution. Original instruction and supporting files are preserved.